❮ Previous Next ❯

The information for building proteins that is encoded in DNA is passed on first to _, which then migrates to an organelle called a __, where the protein is put together.

Adv.

Answer:

Related Questions

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

- Voclasses

A chain of ______ results in a polypeptide chain that folds up into a _____

a. RNA bases ... transcript

b. amino acids ... gene

c. proteins ... ribosome

d. DNA bases ... gene

e. amino acids ... protein

- Voclasses

genetic code is an inventory of which ______ specify(ies) which ___

a. three mRNA bases ... amino acid

b. mRNA base ... amino acid

c. amino acids ... proteins

d. polypeptide chain ... protein

e. three DNA bases ... three mRNA bases

- Voclasses

The “t” of tRNA stands for:

a. tripartite

b. teleporting

c. transfer

d. tracking

e. transcribing

- Voclasses

Which of the following statements is true regarding ribosomes?

a. They are composed of two separate units, each made of rRNA combined with protein.

b. They are used to translate the mRNA sequence into a protein composed of amino acids.

c. They have three different tRNA binding sites

d. all of the above

e. a and b only

- Voclasses

Why can transfer RNA be referred to as a “bridging” molecule?

a. It forms a chemical bridge between DNA and messenger RNA.

b. It creates the linkage between the base pairs of the double helix.

c. It links species through evolution.

d. It links ribosomes together.

e. It binds to both amino acids and messenger RNA.

- Voclasses

A typical eukaryote protein might be ____ amino acids long and could be produced in less than _____ in translation.

a. 50 ... 5 minutes

b. 50,000 ... 5 hours

c. 5 ... 5 seconds

d. 400 ... 2 minutes

e. 4,000 ... 4 minutes

- Voclasses

A typical eukaryote protein might be ____ amino acids long and could be produced in less than _____ in translation.

a. 50 ... 5 minutes

b. 50,000 ... 5 hours

c. 5 ... 5 seconds

d. 400 ... 2 minutes

e. 4,000 ... 4 minutes

- Voclasses

In one form of genetic regulation, proteins called transcription factors bind to _____, thus facilitating the work of _____.

a. ribosomes ... transfer RNA

b. messenger RNA ... ribosomes

c. non-coding DNA sequences ... RNA polymerase

d. coding DNA sequences ... RNA polymerase

e. transfer RNA ... ribosomes

- Voclasses

An intron is a sequence of ____ RNA that is ____ a primary transcript, while an exon is a sequence of ______ RNA that is ______ a primary transcript.

a. non-coding ... cut out of ... coding ... left in

b. transfer ... cut out of ... non-coding ... left in

c. coding ... left in ... non-coding ... cut out of

d. transfer ... left in ... transfer ... cut out of

e. non-coding ... left in ... coding ... left in

- Voclasses

Sub Categories

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Answer:

Related Questions

Categories

Sub Categories

The information for building proteins that is encoded in DNA is passed on first to _, which then migrates to an organelle called a __, where the protein is put together.