Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

genetic code is an inventory of which ______ specify(ies) which ___

a. three mRNA bases ... amino acid

b. mRNA base ... amino acid

c. amino acids ... proteins

d. polypeptide chain ... protein

e. three DNA bases ... three mRNA bases

Which of the following statements is true regarding ribosomes?

a. They are composed of two separate units, each made of rRNA combined with protein.

b. They are used to translate the mRNA sequence into a protein composed of amino acids.

c. They have three different tRNA binding sites

d. all of the above

e. a and b only

A typical eukaryote protein might be ____ amino acids long and could be produced in less than _____ in translation.

a. 50 ... 5 minutes

b. 50,000 ... 5 hours

c. 5 ... 5 seconds

d. 400 ... 2 minutes

e. 4,000 ... 4 minutes

A typical eukaryote protein might be ____ amino acids long and could be produced in less than _____ in translation.

a. 50 ... 5 minutes

b. 50,000 ... 5 hours

c. 5 ... 5 seconds

d. 400 ... 2 minutes

e. 4,000 ... 4 minutes

In one form of genetic regulation, proteins called transcription factors bind to _____, thus facilitating the work of _____.

a. ribosomes ... transfer RNA

b. messenger RNA ... ribosomes

c. non-coding DNA sequences ... RNA polymerase

d. coding DNA sequences ... RNA polymerase

e. transfer RNA ... ribosomes

An intron is a sequence of ____ RNA that is ____ a primary transcript, while an exon is a sequence of ______ RNA that is ______ a primary transcript.

a. non-coding ... cut out of ... coding ... left in

b. transfer ... cut out of ... non-coding ... left in

c. coding ... left in ... non-coding ... cut out of

d. transfer ... left in ... transfer ... cut out of

e. non-coding ... left in ... coding ... left in

In DNA replication, both of the strands of the double helix serve as templates for _______.