Each three _____ bases code for three _____ bases, which code for one ______.

Though there are hundreds of thousands of proteins active in living things, all of them are put together from a starting set of 20 of the building blocks known as _______.

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

A chain of ______ results in a polypeptide chain that folds up into a _____

a. RNA bases ... transcript

b. amino acids ... gene

c. proteins ... ribosome

d. DNA bases ... gene

e. amino acids ... protein

The “t” of tRNA stands for:

a. tripartite

b. teleporting

c. transfer

d. tracking

e. transcribing

Why can transfer RNA be referred to as a “bridging” molecule?

a. It forms a chemical bridge between DNA and messenger RNA.

b. It creates the linkage between the base pairs of the double helix.

c. It links species through evolution.

d. It links ribosomes together.

e. It binds to both amino acids and messenger RNA.