Small lengths of RNA called ________ have the effect of “silencing” genes in the genome by means of targeting their ________ for destruction or otherwise interfering with them.

In eukaryotic organisms such as ourselves, the RNA chains, called primary transcripts, that code for proteins must undergo _______ on their way to becoming ________. The segments of the primary transcripts that are removed in this process are called ________, while the segments that are retained are called ________.

DNA passes on its information to messenger RNA by means of ________.

Each three _____ bases code for three _____ bases, which code for one ______.

Though there are hundreds of thousands of proteins active in living things, all of them are put together from a starting set of 20 of the building blocks known as _______.

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

A chain of ______ results in a polypeptide chain that folds up into a _____

a. RNA bases ... transcript

b. amino acids ... gene

c. proteins ... ribosome

d. DNA bases ... gene

e. amino acids ... protein

The “t” of tRNA stands for:

a. tripartite

b. teleporting

c. transfer

d. tracking

e. transcribing