As a means of producing large quantities of cells needed for the regeneration of human tissues, medical scientists are utilizing:

a. somatic cell nuclear transfer, plasmids, and gene splicing.

b. gene splicing, polymerase chain reaction, and transgenic organisms.

c. embryonic stem cells and induced pluripotent stem cells.

d. somatic cell nuclear transfer, embryonic stem cells, and induced pluripotent stem cells.

e. gene splicing, cloned cells, and transgenic organisms.

Criminal investigators who want to make copies of a DNA sample from a crime do so through:

a. the polymerase chain reaction.

b. transformation.

c. cloning vectors.

d. DNA sequencing.

e. iPS cells.

A central feature of genetic regulation is that proteins called transcription factors bind to non-coding _____, thus regulating the _______ of genes.

Small lengths of RNA called ________ have the effect of “silencing” genes in the genome by means of targeting their ________ for destruction or otherwise interfering with them.

In eukaryotic organisms such as ourselves, the RNA chains, called primary transcripts, that code for proteins must undergo _______ on their way to becoming ________. The segments of the primary transcripts that are removed in this process are called ________, while the segments that are retained are called ________.

DNA passes on its information to messenger RNA by means of ________.

Each three _____ bases code for three _____ bases, which code for one ______.

Though there are hundreds of thousands of proteins active in living things, all of them are put together from a starting set of 20 of the building blocks known as _______.

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA