Criminal investigators who want to make copies of a DNA sample from a crime do so through:

a. the polymerase chain reaction.

b. transformation.

c. cloning vectors.

d. DNA sequencing.

e. iPS cells.

A central feature of genetic regulation is that proteins called transcription factors bind to non-coding _____, thus regulating the _______ of genes.

Small lengths of RNA called ________ have the effect of “silencing” genes in the genome by means of targeting their ________ for destruction or otherwise interfering with them.

In eukaryotic organisms such as ourselves, the RNA chains, called primary transcripts, that code for proteins must undergo _______ on their way to becoming ________. The segments of the primary transcripts that are removed in this process are called ________, while the segments that are retained are called ________.

DNA passes on its information to messenger RNA by means of ________.

Each three _____ bases code for three _____ bases, which code for one ______.

Though there are hundreds of thousands of proteins active in living things, all of them are put together from a starting set of 20 of the building blocks known as _______.

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

A chain of ______ results in a polypeptide chain that folds up into a _____

a. RNA bases ... transcript

b. amino acids ... gene

c. proteins ... ribosome

d. DNA bases ... gene

e. amino acids ... protein