All Questions page - 581

What limits, if any, should be put on the ability of human beings to modify the genomes of other living things? Should human beings be free to carry out any modification that does not harm an organism?

In transgenic biotechnology involving bacteria, which sequence of events would be followed in the process of harvesting a protein of interest?

a. Replicate host bacterial cells; isolate gene that codes for protein; splice gene into plasmids; harvest protein of interest; transform plasmids into bacteria.

b. Transform plasmids into bacteria; isolate gene that codes for protein; replicate host bacterial cells; splice gene into plasmids; harvest protein of interest.

c. Harvest protein of interest; isolate gene that codes for protein; splice gene into plasmids; replicate host bacterial cells; transform plasmids into bacteria.

d. Isolate gene that codes for protein; splice gene into plasmids; replicate host bacterial cells; transform plasmids into bacteria; harvest protein of interest.

e. Isolate gene that codes for protein; splice gene into plasmids; transform plasmids into bacteria; replicate host bacterial cells; harvest protein of interest.

Which of the following is an example of a transgenic organism?

a. E. coli bacterium with a human gene inserted

b. Dolly the sheep

c. rice with bacterium and daffodil genes inserted

d. all of the above

e. a and c only

What is a clone?

a. an exact genetic copy of a gene or an entire living thing

b. a cell that can take up plasmids

c. a segment of DNA of a specified length

d. an offspring produced by test-tube fertilization

e. a segment of DNA that can prime the polymerase chain reaction

Dolly the sheep was cloned by means of:

a. applying an electric current to an egg and sperm in a laboratory.

b. taking an embryo from one sheep and implanting it in another.

c. taking a cell from an adult sheep and fusing it with a sheep egg that had its DNA removed.

d. inserting new genes into an existing mammary cell.

e. getting sperm to fuse with egg outside a living sheep.

As a means of producing large quantities of cells needed for the regeneration of human tissues, medical scientists are utilizing:

a. somatic cell nuclear transfer, plasmids, and gene splicing.

b. gene splicing, polymerase chain reaction, and transgenic organisms.

c. embryonic stem cells and induced pluripotent stem cells.

d. somatic cell nuclear transfer, embryonic stem cells, and induced pluripotent stem cells.

e. gene splicing, cloned cells, and transgenic organisms.

Criminal investigators who want to make copies of a DNA sample from a crime do so through:

a. the polymerase chain reaction.

b. transformation.

c. cloning vectors.

d. DNA sequencing.

e. iPS cells.

A central feature of genetic regulation is that proteins called transcription factors bind to non-coding _____, thus regulating the _______ of genes.

Small lengths of RNA called ________ have the effect of “silencing” genes in the genome by means of targeting their ________ for destruction or otherwise interfering with them.

In eukaryotic organisms such as ourselves, the RNA chains, called primary transcripts, that code for proteins must undergo _______ on their way to becoming ________. The segments of the primary transcripts that are removed in this process are called ________, while the segments that are retained are called ________.

DNA passes on its information to messenger RNA by means of ________.

Each three _____ bases code for three _____ bases, which code for one ______.

Though there are hundreds of thousands of proteins active in living things, all of them are put together from a starting set of 20 of the building blocks known as _______.

The information for building proteins that is encoded in DNA is passed on first to _______, which then migrates to an organelle called a ________, where the protein is put together.

Given the following sequence of mRNA, what would the resulting amino acid sequence be?

AUGAAACGGGGACCAAUGGAUAACUAA

A chain of ______ results in a polypeptide chain that folds up into a _____

a. RNA bases ... transcript

b. amino acids ... gene

c. proteins ... ribosome

d. DNA bases ... gene

e. amino acids ... protein